Search tab

VCF Genotype Search

New feature

This search allows a user to view the genotypes for a set of accessions of interest at a small subset of markers. The user only needs to know the accessions of interest and marker names to generate a summary table in a few seconds.

VCF Genotype Search inputs

This search requires two inputs, the names of the samples to be searched and the feature names. Some example inputs are shown below:

Sample names

AGG409647BARL1-B00001-1-03
AGG409740BARL1-B00001-1-04
AGG410003BARL1-B00001-1-05

Feature names

AVRIG00246
AVRIG00484

While these inputs can be entered manually, the easiest way to get the sample names is to load a VCF file and select the samples of interest.

Within the box, first select your VCF to search. This will load the VCF and give you a list of all the available samples.

If anything is entered into the Search/Filter box, the list will be filtered to match the search term. Clicking on a sample will add it to the list of samples to be searched.

Features can be added by entering the feature names into the Features input text box.

(Optional) Loading multiple samples

Note

The following search has only been tested up to 1000 samples. The interface will become extremely slow if a larger number of samples are selected. If it does become slow refresh the page to restart.

To select a range of samples, hold down the CTRL key and select another sample in the list.

View results

Once the search button is pressed the results will be displayed in a table on the right hand panel in the Genotypes tab.

(Optional) Selecting additional features from the view

Adding additional features to the search can be done by entering the feature names into the Features input text box. Or it can be done by selecting the features from the axis.

Feature search

VCF Search inputs

Note

Only full names will be accepted by the feature search, and there needs to be an exact match including capitalisation. Most features are stored in their capitalised format.

Once the feature names have been inputted into the search box. Please press the search button to view the search results.

An example search is shown below:

Feature names

AVRIG33950
IWB31543  

View results

The search results will be displayed under the Feature Search box. To view the results and its location on the genome, click the green plus icon on the left side of each search result. This will load in the relevant chromosome with a blue arrow pointing to the feature. The arrow can be clicked on to display the feature name.

Adding or Removing feature names

To add additional features to the search, add the new feature names to the existing search and press the search button again.

An example of the new search query is shown below with the new feature IWB65513:

Feature names

AVRIG33950
IWB31543
IWB65513

To remove a displayed feature, simply remove the feature name from the input list and click search again.

To view features between specified features

Brush the axes between the features, and select the Features tab on the right side. All features will be displayed in a table format.

DNA Sequence Blast Search

BLAST search inputs

To perform a BLAST search, please input both a DNA sequence and select a reference genome to search against.

An example search is shown below:

DNA sequence

>WAPO1
ATGAACCTACTGCCTCACCACCACCTGTCGCTGCCGTCTGGGCCTGGCCGCCGCCCCTCCTCTGCGGCGGAGGCGGTGGAGATGGACCCGCGCGTGTGGCGCCGCCTGCCGCAGCCGCTGCTGGACCGCGTGCTGGCGTTCCTCCCGACGCCGTCCTTCCTCCGCGCCCGCGCCGTCTGCCGCCGCTTCTACCACCTCCTCTTCTCCTCCCCGTTCCTCCACTCTCACCTCCTCCACTCCCCGCACCTCCCCTTCTTCGCCTTCGCCGTCCCCTCCGCCGGCCACCTCCTCCTCCTCGATCCCACCTCCCAGCCGCAGGGACCCTCCTGGTTCCTCCTCCCGCTCCCGATCCCAGGTCCCGCCGCGGGGTTCTCGCCGGCTCCCGCGTCCGCTGGCCTGCTGGCGTTCCTCTCCGACGCGTCCGGCCACAAGACGCTGCTCCTCGCCAACCCCATCACGCGCCTCCTCGCCGCGCTGCCGCTCGGCCCCACGCAGCGCCTCTCCCCCACCGTCGGCCTGGCCGCGGGGTCGACGTCCATCATCGCCGTCGTGGCTGGCGACGACCTCGTGTCCCCTTTCGCCGTCAAGAACATCTCCGTCGACACCTTCGTCGCCGACGCCGCCTCCGTCCCGTCCTCCGGCTTCTGGGCCCCCAGCTCCCTCCTGCCACGCCTGTCCTCCCTCGATCCTCGCGCCGGCATGGCCTTCGCCTCCGGAAGGTTCTACTGCATGAGCTCGTCGCCGTTCGCGGTTCTCGTGTTCGACGTGGCGGCGAACGTCTGGAGCAAGGTGCAGCCGCCGATGAGGCGGTTCCTGCAGTCGCCGGCGCTGGTCGAGCTCGGCGGCGGCAGGGAGGGCTCGGGCACCGCAAGGGTGGGGCTCGTCGCGTCCGTGGAGAAGAGCCGTCTCAGCGTGCCGCGGAGCGTGCGCGTCTGGACACTGCGCGGCAGAGGAGGCTCCGGCGGCGGCGGCGGCGCGTGGAGCGAGGTGGCGCGGATGCCGCAGGACGTGCACGCGCAGTTCGCGGCGGCGGAGGGCGGCCGCGGGTTCGAGTGCGCAGCGCACGGCGACTTCGTCGCGCTAGCGCCCCGCGGCGGGCCGGCAGCCGTGCCGGTGCCGACGACCGTGCTCGTGTTCGACTCGCGCCGCGACGAGTGGCGGTGGGCGCCACCATGCCCATACGTCGGGCACGGCATGGCCGCAGTGGTCAACGGCGGAGGCGCGGGGTTCCGGGTCCTCGCGTACGAGCCACGCCTGGCGACGCCGGCCATCGGCCTTCTGGACGCCACGACGCCGGTGGCTTTGCATGGGATGCATGGTTAG

Reference genome

Triticum aestivum - Genome - IWGSC_RefSeq_v2.1

Optional inputs

The following search parameters can also be added to search to filter the returned results.

Search Parameter	Description
Rows	The number of results returned from the search
Length of Hit	The minimum length of a match
% Identity	The minimum similarity value for a match
% Coverage	The minimum coverage for a match

View Results

To view results, the user can select/deselect the hits by clicking on square boxes under the view tab in the raw output data. Further, by clicking on the expand arrow (top right corner of BLAST output), the user can view the BLAST results in table format and can also select/deselect the samples.